La consommation de la matière oranique et flux d'énergie

L’ATP est un intermédiaire métabolique indispensable pour toutes activités cellulaires. Les cellules vivantes régénèrent leur ATP par oxydation des molécules organiques en adoptant des voies métaboliques différentes.
Afin d’expliquer la différence de la taille des colonies chez deux souches de levure de boulangerie P et G (Saccharomyces cerevisiae) et sa relation avec la voie métabolique adoptée on propose les données suivantes:
Dans deux boîtes de Pétri identiques, on cultive les deux souches de levures sur un milieu gélosé complet contenant notamment 5 % de glucose et abondamment oxygéné. Les cultures sont placées à une température constante. Le document 1 montre l’aspect des colonies des levures au début et à la fin de cette culture.

1. sachant qu’une colonie est le résultat de la multiplication des cellules :
a. Comparez les résultats à la fin de culture (document 1) pour les deux souches de levures P et G. 
b. Proposez une hypothèse pour expliquer la différence observée au niveau des colonies des souches P et G.

Pour expliquer la différence observée et sa relation avec le métabolisme cellulaire, on cultive les deux souches P et G sur un milieu gélosé dépourvu de glucose et abondamment oxygéné placé à une température constante, puis on mesure la variation de la concentration de dioxygène avant et après l’ajout de la même quantité de glucose dans le milieu de culture.
Les résultats obtenus sont représentés dans le document 2. Une observation des deux souches de levures au microscope électronique à la fin de cette expérience a permis d’obtenir les résultats présentés par le
document 3.


2. En exploitant les résultats présentés par les documents 2 et 3, déduisez la voie métabolique adoptée par chacune des deux souches de levure P et G. 

Pour comparer l’activité métabolique adoptée par chaque souche de levure, on applique le triphényl- tétralozium sur chaque colonie des deux souches G et P. Parallèlement, on a mesuré la quantité d’ATP produite par les souches G et P et calculé le rendement énergétique respectif pour chacune de deux souches.
Le document 4 présente les résultats obtenus.
Le document 5 représente les deux voies métaboliques utilisées par les souches P et G pour produire l’ATP.

Remarque : Le triphényl-tétralozium est utilisé par les levures comme accepteur final des électrons de la chaîne respiratoire des mitochondries à la place du dioxygène. Dans ces conditions, il est réduit en un composé de couleur rouge : le formazan.

*bilan de consommation d’une molécule de Krebs pyruvate au niveau de la mitochondrie.
Au niveau de la mitochondrie, l’oxydation de 1NADH,H+ donne 3ATP et l’oxydation de 1FDH2 donne 2ATP.

3. En utilisant les données des documents 4 et 5 expliquez la différence du rendement énergétique observée chez les deux souches P et G. 
4. En mettant en lien la taille des colonies, la structure cellulaire et la voie métabolique adoptée, vérifiez votre hypothèse.

1 – a- il y a une multiplication des deux souches P et G et la formation de colonies ;
– La taille des colonies de la souche G est plus grande que celle des colonies de la
souche P.

1 – b –  Une hypothèse logique qui relie la taille des colonies avec la voie métabolique adoptée, par exemple :
La souche G adopte une voie métabolique aérobie ce qui lui permet de former des colonies de grande taille alors que la souche P adopte une voie métabolique anaérobie et par conséquence ces colonies restent de petite taille.

2 – Exploitation du document 2 :
Pour la souche G : diminution de la concentration en O2 après l’ajout du glucose au milieu de culture ;
Pour la souche P : une très faible diminution de la concentration en O2 après l’ajout du glucose au milieu de culture ;
Exploitation du document 3 :
la souche G : possède des mitochondries développées (avec des crêtes), de grande taille et nombreuses ;
la souche P : possède des mitochondries non développées (sans crêtes), de petite taille et peu nombreuse ;

Déduction : 
Les cellules de la souche G adoptent la voie de la respiration
Les cellules de la souche P adoptent la voie de la fermentation 

3 – La coloration rouge de la colonie de la souche G est due au fait que ses cellules ont réduit l’accepteur final des électrons au niveau de la chaîne respiratoire, car elles adoptent la voie respiratoire.
– Par respiration, la souche G produit, à partir de l’oxydation d’une molécule de glucose, 4ATP, 10NADH,H+

et 2FADH2 → bilan énergétique 38 ATP → rendement énergétique important 40%; 
– Les colonies de la souche P non colorées en rouge indiquent qu’elles n’ont pas réduit l’accepteur final des électrons car elles adoptent la voie de fermentation alcoolique.
– Par fermentation, la souche P produit, à partir de l’oxydation d’une molécule de glucose, 2ATP, → bilan énergétique 2 ATP → rendement énergétique faible 2%;

4 – vérification de l’hypothèse :
– la souche G possède des mitochondries développées et nombreuse ce qu’elle rend capable d’oxyder le glucose par la voie de respiration à fort rendement énergétique ce qui lui a permet de former de colonies de grande taille ;
– la souche P adopte la voie de fermentation alcoolique à faible rendement énergétique, pour libérer l’énergie emmagasinée dans le glucose, ce qui explique la taille petite des colonies.

I. Donnez :

1. deux caractéristiques structurales de la membrane interne mitochondriale. (0.5 pt)
2. deux caractéristiques de la fermentation. (0.5 pt)
II. Recopiez, sur votre feuille de rédaction, la lettre qui correspond à chaque proposition, et écrivez devant chacune d’elles « vrai » ou « faux » :

a Le cycle de Krebs produit trois molécules de NADH,H+ à partir d’une molécule d’acide pyruvique.

b Le bilan global de la glycolyse est de quatre molécules d’ATP.
c La fermentation lactique produit de l’acide lactique et du dioxyde de carbone.
d La longueur des myofilaments reste constante au cours de la contraction du sarcomère.

III.Recopiez, sur votre feuille de rédaction, les couples (1, ….) ; (2, ….) ; (3, ….) ; (4, ….) et reliez chaque molécule à son action, en adressant à chaque numéro du groupe 1 la lettre correspondante du groupe 2.

Groupe 1 : Molécules                        Groupe 2 : Action
1. ATP                                                 a. phosphoryle l’ADP
2. Ca2+                                              b. se fixe à la tête de myosine
3. Myosine                                        c. se fixe à la Troponine
4. ATP synthase                              d. se lie à l’Actine

I – 1 – Deux caractéristiques structurales de la membrane interne mitochondriale. 
Par exemple : Riche en protéines ; presente des extensions au niveau de la membre interne (les crêtes) ; présence des sphères pédonculées et des complexes de la chaine respiratoire.
 2 – Deux caractéristiques de la fermentation.
Par exemple :-Se déroule en absence d’O2  ; produit des résidus organiques ; se déroule au niveau du hyaloplasme.

II – (a- vrai) ; (b- faux) ; (c- faux) ; (d- vrai)

III – (1, b) ; (2, c) ; (3, d) ; (4, a)

Des Ievures sont cultivées dans un milieu oxygéné contenant une faible quantité de glucose radioactif (G) marqué au 14C. On effectue des prélèvements aux temps t0 à t4 et on remarque l’apparition de
nouvelles molécules radioactives : de l’acide pyruvique (P), des molécules du cycle de Krebs (K) et du CO2.

Le tableau suivant montre localisation des molécules radioactives en fonction du temps.

choisir  la ou les bonnes réponses.

Cette expérience montre que :

a- Le CO2 provient des réactions dans le hyaloplasme
b – Le CO2 provient de réactions dans la mitochondrie
c – Le glucose est directement dégradé dans la mitochondrie
d- Le glucose est oxydé en pyruvate

les bonnes réponses sont : 

b – Le CO2 provient de réactions dans les mitochondries
d- Le glucose est oxydé en pyruvate

A- Dans le muscle vivant, il est possible de suivre l’évolution des quantités de trois composés phosphatés : l’ATP (adénosine triphosphate), la phosphocréatine et le phosphate inorganique
(Pi). La technique utilisée permet de détecter les atomes de phosphore. Ainsi, l’ATP qui en possède trois présente trois pics.
On considère un muscle avant tout effort (a), on lui fait subir un effort intense pendant deux minutes (b) suivi d’une période de récupération de quatre minutes(c). L’amplitude des pics obtenus par cette technique est proportionnelle à la quantité des composés phosphatés étudiés (voir document 1)

1. Décrivez l’évolution de la concentration d’ATP dans le muscle au cours de l’expérience.

2. Comparez l’évolution de la quantité de phosphocréatine et de Pi au cours de l’expérience. 

3. Etablissez la relation entre les variations de ces trois composés phosphatés durant cette expérience.

B- Au cours de toute activité musculaire, l’énergie nécessaire à la contraction musculaire est fournie par un ensemble de réactions métaboliques.

Afin de déterminer la nature des différentes voies métaboliques productrices d’énergie et leur ordre d’intervention au cours d’un exercice musculaire d’intensité modérée, une course de 800 mètres par
exemple, on effectue les mesures traduites par les trois courbes du document 2.

4. A partir de l’exploitation du document 2, donnez l’ordre chronologique des réactions métaboliques et leurs caractéristiques respectives.

D’aprés Bac sn 2014

A.
1) Le document 1 montre que la concentration de l’ATP reste constante au cours de cette expérience. En effet l’amplitude des pics de ce composé est la même pendant cette expérience.

2) Avant l’effort la quantité de phosphocréatine est plus importante que celle de Pi.

 Pendant la récupération, la quantité de Pi diminue alors que celle de phosphocréatine augmente. En effet ces composés retrouvent leurs valeurs initiales lors de la phase de récupération.

3) L’ATP est la source d’énergie directement utilisée par le muscle en activité. La constance de sa quantité s’explique par sa régénération rapide grâce à l’hydrolyse de la phosphocréatine. Cette hydrolyse est à l’origine de la baisse du taux de ce composé pendant l’effort, pendant que le taux de Pi, (résultant de l’hydrolyse), augmente.
Pendant la phase de récupération, on assiste à une régénération de la phosphocréatine aux dépens du Pi. Chacun d’eux revient à son taux initial.

B.
4) Le document 2 montre que durant l’activité musculaire, l’énergie nécessaire provient des réactions métaboliques, chronologiques, suivantes :

 Il y a d’abord la voie de la créatine phosphate qui permet une importante production d’énergie mais de façon brève.

 Ensuite nous avons la voie de la glycolyse anaérobie qui permet une plus faible production d’énergie que la première voie, mais qui est plus durable que celle-ci.

 Enfin, nous avons la voie de l’oxydation aérobie qui produit une plus faible quantité d’énergie que les deux premières voies mais qui se poursuit durant toute la durée de l’exercice

On cherche à étudier quelques aspects du mécanisme de la contraction musculaire et à montrer le rôle des ions Ca 2+ dans ce mécanisme. Dans ce cadre on propose les données suivantes :

  • Donnée 1 : Des fibres musculaires striées sont isolées et cultivées dans un milieu physiologique contenant des ions calcium radioactifs (45Ca2+) puis elles sont réparties en deux lots 1 et 2. Les fibres du lot 1 sont fixées en état de relâchement alors que les fibres du lot 2 sont fixées en état de contraction. Par autoradiographie, on détecte la localisation de la radioactivité au niveau des fibres de chaque lot. Les figures du document 1 présentent des schémas explicatifs des résultats de cette détection (la figure a  pour les fibres du lot 1, la figure b  pour les fibres du lot 2).

  1. Comparez la répartition de la radioactivité dans les fibres des lots 1 et 2, puis dégagez le sens de déplacement des ions calcium lorsque la fibre musculaire passe de l’état de relâchement à l’état de contraction. 
  • Donnée 2: L’étude biochimique et l’observation électronographique des myofilaments d’actine et de myosine, dans des fibres musculaires en présence et en absence d’ions Ca2+, ont permis de construire le modèle explicatif présenté dans le document 2.

  1. En vous basant sur les résultats présentés dans le document 2, montrez comment interviennent les ions Ca2+ dans la contraction de la fibre musculaire.  
  • Donnée 3: Pour extraire l’énergie nécessaire à sa contraction, la fibre musculaire hydrolyse de grandes quantités d’ATP. Afin de déterminer certaines conditions nécessaires à l’hydrolyse de ces molécules, on présente les données expérimentales du document 3.

  1. En exploitant les données du document 3, expliquez la différence d’hydrolyse de l’ATP observée dans les différents milieux. 
  2. En vous basant sur les données précédentes et sur vos connaissances, résumez l’enchainement des événements conduisant à la contraction du muscle suite à une excitation.                             

D’aprés Bac Ma 2016

1 – Comparaison

– Pour le premier lot : forte radioactivité (Ca2+) au niveau du réticulum sarcoplasmique en comparaison avec le sarcoplasme

–  Pour le deuxième lot : faible radioactivité (Ca2+) au niveau du  sarcoplasme en comparaison avec le réticulum sarcoplasmique

 Déduction: lors du passage de l’état de relâchement à l’état de contraction, les ions  Ca2+ passent du  réticulum sarcoplasmique vers le  sarcoplasme

2 – Mécanisme de l’intervention des ions Ca2+ dans la contraction de la fibre musculaire:

fixation des ions  Ca2+ sur la troponine → libération des sites de fixation des têtes de myosines sur l’actine suite au déplacement de la tropomyosine → formation du complexe actomyosine

3 –Explication :

-L’hydrolyse de grandes quantités  d’ATP dans le milieu 1 s’explique par la formation du  complexe actomyosine

-L’hydrolyse de faibles quantités  d’ATP dans le milieu 3 s’explique par l’absence du  complexe actomyosine car ce milieu ne contient que la myosine

4 –La succession des événements depuis l’excitation à la contraction musculaire : 

– suite à l’excitation du muscle, les ions  Ca2+   sont  libérés à partir du  réticulum sarcoplasmique;

– libération des sites de fixation des têtes de myosines;

– formation des complexes actomyosine;-rotation  des têtes de myosines aboutissant au glissement des filaments d’actine entre les filaments  de myosine ce qui entraine  la contraction musculaire

L'information génétique

En 1960, le biologiste Gurdon réalise l’expérience de transfert de noyau cellulaire suivante :

Source :svt.ac-dijon.fr

1- Décrivez l’expérience de Gurdon.

2 – Que peut on conclure des résultats de cette expérience.

1 – Gurdon a détruit le noyau d’un ovule (cellule sexuelle ) de Xénope vert et le remplace par le noyau d’une cellule d’intestin (cellule somatique ) de têtard albinos. Il  a obtenu des xénopes albinos.

2 – On observe que les xénopes obtenus sont tous albinos c’est à dire ils ont le même caractère ( la couleur de la peau ) que celui des tétards dont on a prélevé le noyau. Le noyau de la cellule d’intestin permet de construire et faire fonctionner un individu complet. Donc c’est le noyau qui contient l’information génétique.

Exerice 2:

Le document suivant montre un schéma d’un tissu végétal en mitose.

1. Pour chaque lettre, identifiez la phase correspondante.

1°) A : anaphase

B : prophase

C : télophase

D : métaphase

Exerice 3:

Le document ci-dessous montre des images de l’évolution du matériel génétique au cours de la mitose. La technique utilisée est l’électronographie à balayage.

1. Pour chaque image, donnez le nom de la phase correspondante en justifiant votre réponse.

2. Classez ces dix électronographies dans l’ordre chronologique correspondant au déroulement d’une mitose.

1. Nom des phases
a. Milieu de prophase : un seul noyau visible, matériel génétique partiellement condensé
b. Début d’anaphase : les chromatides des chromosomes commencent à se séparer et à migrer
c. Fin d’anaphase / début de télophase : formation de 2 lots de chrs aux pôles cellulaires
d. Télophase : présence de 2 noyaux avec chrs en cours de décondensation
e. Anaphase : chrs en fin de migration aux pôles cellulaires
f. Fin interphase / début prophase : un seul noyau visible, matériel génétique sous forme de chromatine
g. Métaphase : chrs alignés au milieu de la cellule
h. Fin de prophase : un noyau avec chrs condensés, répartition aléatoire
2. Ordre chronologique
f -> a -> h -> g -> b -> e -> c -> d

Exerice 4:

L’expression de l’information génétique passe par la synthèse des proteines qui comprend deux étapes.

1. Donnez le nom des 2 étapes de la synthèse d’une protéine dans l’ordre chronologique.

2. Détrminez leur localisation.

1.  a – La transcription : la synthèse d’un ARNm à partir du brin transcrit de l’ADN

b -La traduction : la synthèse d’un polypeptide à partir d’un ARNm
2. La transcription se déroule dans le noyau
La traduction se déroule dans le cytoplasme

Exerice 5:

Le document suivant montre les étapes de l’expression de l’information génétique

1. Donnez le nom des étapes 1 et 2.

2. Détrminez le nom des éléments A : B : C : D :  E : X : Y : Z : 
3. Précisez le rôle de l’élément D.

1) 1 : transcription ; 2 : Traduction.
2) A : ribonucléotide
B : acide aminé / méthionine
C : Protéine
D : Ribosome
E : ARN polymérase
X : double hélice ADN
Y : ARNm
Z : ARNt / anticodon
3) Ribosome : rôle de synthèse des protéines.

Exerice 6:

Chez les mammifères, la post-hypophyse élabore des hormones de nature polypeptidique : l’ocytocine qui favorise les contractions utérines.
Extrait de la séquence de bases de la portion d’ADN non transcrit pour l’ocytocine
T G C T A C A T C C A G A A C T G C C C C C T G G G C

1. Ecrire le brin d’ARN messager correspondant
2. Ecrire la séquence d’acides aminés correspondant à l’ARN messager.

1) ARNm : UGCUACAUCCAGAACUGCCCCCUGGGC 
2) Protéine : Cys-Tyr-Ile-Gln-Asn-Cys-Pro-Leu-Gly. 

Exerice 7:

L’insuline est une hormone protéique sécrétée par certaines cellules du pancréas et intervenant dans la régulation du taux de glucose sanguin. La molécule d’insuline est constituée de deux chaînes polypeptidiques (chaîne A qui comprend 21 acides aminés et chaîne B de 30).
Séquence de nucléotides de l’ARN messager intervenant dans la mise en place des derniers acides aminés de la chaîne B de l’insuline humaine
G G C U U C U U C U A C A C U

1. Ecrire la séquence des derniers acides aminés de la protéine.
2. Donner la séquence des bases azotées du brin d’ADN non transcrit et du brin transcrit.

1) Protéine : Gly-Phe-Phe-Tyr-Thr. 
2) Brin transcrit : CCGAAGAAGATGTGA 
Brin non transcrit : GGCTTCTTCTACACT. 

Exerice 8:

Soit la séquence des nucléotides d’un gène représentée ci-dessous :
…….TACGACCACCTCTCCACGGAC….. brin d’ADN transcrit

1. Ecrire la séquence de la protéine.
2. Sur le brin d’ADN transcrit, on remplace le nucléotide de la position 4 par un nucléotide à Adénine.
    a- comment se nomme cette mutation ?
    b – quelle est sa conséquence ?
    c – quelle propriété du code génétique a-t-on mis en évidence ?
 
3. On incorpore sur le brin d’ADN transcrit un nucléotide à Thymine entre les nucléotides 6 et 7.
    a – comment nomme-t-on cette mutation ?
    b – quelle est sa conséquence ?

1) Protéine : Met-Leu-Val-Glu-Arg-Cys-Leu 
2) Sur le brin d’ADN transcrit, on remplace le nucléotide de la position 4 par un nucléotide à Adénine.
    a – Subsitution 
    b – Mutation silencieuse 
    c -Redondance
3) On incorpore sur le brin d’ADN transcrit un nucléotide à Thymine entre les nucléotides 6 et 7.
     a -Addition 
     b -Décalage du cadre de lecture : mutation faux sens 

Exerice 9:

Des levures (champignons unicellulaires) sont mises en culture dans un milieu de culture adapté. La souche de levures étudiée synthétise une substance qui leur donne une couleur rouge. C’est la conséquence de la transformation d’une molécule précurseur par une enzyme (protéine à action catalytique, codée par un gène). Après quelques jours de culture, on observe que la plupart des colonies formées sont de couleur rouge, mais certaines sont de couleur blanche.

1- Formulez une hypothèse permettant d’expliquer ce résultat. 

1°) les levures blanches provenant de la division des levures rouges, on peut supposer que ces dernières ont subi une mutation d’un gène qui contrôle la couleur.

Pour vérifier cette hypothèse, on cultive à nouveau cette souche de levures en l’exposant à un rayonnement ultraviolet. On mesure le pourcentage de colonies blanches formées au bout de quelques jours de culture en fonction de l’intensité du rayonnement (Doc 1).

Par ailleurs, on mesure le nombre de colonies blanches par rapport au nombre total, puis on calcule la fréquence d’apparition de ces colonies pour différentes longueurs d’ondes de rayonnements UV. En même temps, on détermine pour chaque longueur d’onde, la proportion du rayonnement absorbé par l’ADN et les protéines (Doc 2).

On a analysé l’ADN des levures appartenant aux 2 types de colonies. Le tableau suivant présente un extrait de sa séquence pour chacune des colonies :

2. En exploitant les documents 1 et 2, décrivez et expliquez l’effet du rayonnement ultraviolet sur les levures.

3. En exploitant le document 3, comparez les extraits de séquence des deux molécules d’ADN.

4. Précisez l’effet du rayonnement UV sur les levures et expliquez l’apparition de colonies blanches en l’absence de rayonnement.

2°) Doc 1 : on observe que le pourcentage de colonies blanches augmente avec l’intensité du rayonnement : à 1 U.A. ; il y a 2 % de levures alors qu’à 4 U.A., il y en a 12 %.
Doc 2 : la quantité de levures blanches est maximale pour un rayonnement de 260 nm où le nombre de levures blanches atteint presque 10 pour 10000.
On constate par ailleurs (Doc 2) que l’absorption des UV par l’ADN est maximale pour cette même longueur d’onde, ce qui n’est pas le cas pour les protéines (pic d’absorption à 280 nm).
On en déduit que les UV modifient la couleur des levures en agissant sur leur ADN.
3°) La comparaison des deux extraits de séquence de l’ADN montre une mutation par substitution d’un nucléotide à T par un nucléotide à G en position 8 chez les levures de couleur blanche.
4°) Il s’agit donc d’une mutation provoquée par les UV. Elle se traduit par un changement de couleur de la colonie. Cette mutation affecte le gène contrôlant la couleur. Elle porte vraisemblablement sur le gène de l’enzyme impliquée dans la transformation du précurseur en substance rouge.
Le même type de mutation peut se produire spontanément ce qui explique l’apparition de colonies blanches en absence de rayonnement.

Exerice 10:

L’hémochromatose héréditaire est une maladie due à une anomalie dans l’absorption intestinale du fer. La maladie se manifeste après 40 ans sous forme de complications hépatiques, cardiaques, cutanées, articulaires et endocriniennes. Cette maladie est liée à une protéine, appelée « Hépcidine », secrétée par le foie dans le sang. Cette protéine  régule l’absorption du fer au niveau des intestins.

    L’analyse du sang chez deux individus, l’un sain et l’autre atteint  de cette maladie, a  donné les résultats présentés dans le document 1.

Docuement 1
  • La synthèse de l’Hépcidine est contrôlée par un gène localisé sur le chromosome 6. Ce gène existe sous deux formes allèliques: l’allèle responsable de la synthèse de l’Hépcidine normale et l’allèle responsable de la synthèse de l’Hépcidine anormale.

 Le document 2 présente un fragment du brin d’ADN transcrit pour chacun des deux  allèles responsables de la synthèse de l’Hépcidine chez un individu sain et chez un individu malade.  

    Le document 3 présente un extrait du tableau du code génétique.

Docuement 2
Docuement 3

1. En exploitant le document 1, Comparez la quantité du fer absorbée et celle emmagasinée dans les organes entre l’individu sain et l’individu atteint et montrez l’existence d’une relation protéine – caractère. 

2. En vous basant  sur les documents 2 et 3, déterminez la séquence de l’ARNm et celle de la chaîne peptidique qui correspondent aux deux allèles du gène étudié, puis montrez l’existence d’une relation gène – protéine.

  1. Comparaison :

    La quantité du fer absorbée au niveau intestinal chez l’individu malade est supérieure à celle absorbée chez l’individu sain

    –  La quantité du fer emmagasinée dans les organes chez l’individu malade est supérieure à celle emmagasinée chez l’individu sain

    Mise en évidence de la relation protéine-caractère:

    En présence d’une Hépcidine anormale, la quantité du fer absorbée au niveau intestinal et celle emmagasinée dans les organes sont très importantes ce qui est à l’origine des différents symptômes caractéristiques de la maladie

  2. Chez l’individu sain :

    Séquence d’ARNm :               UAU GCA CGG UCC ACC 

    Séquence  peptidique :          Tyr – Ala – Arg – Ser – Thr

    Chez l’individu malade :

    Séquence d’ARNm :               UAU GCA UGG UCC ACC  

    Séquence  peptidique :          Tyr – Ala – Trp – Ser – Thr 

    Mise en évidence de la relation gène protéine:

    – Mutation au niveau de l’ADN  par substitution  du  nucléotide 1066 (G)  par le nucléotide (A) →remplacement de l’acide aminé Arg par l’acide aminé Trp au niveau de la séquence peptidique   → Hépcidine  anormal

Exerice 11:

Les figures du document ci-dessous représentent certaines phases d’un phénomène biologique chez une cellule animale dont la formule chromosomique est 2n = 4.

1. Identifiez, en justifiant votre réponse, les phases représentées par le document précédent et déduisez le phénomène biologique étudié.

2. Réalisez le schéma de la deuxième possibilité de la disposition des chromosomes de la phase représentée par la figure b du document précédent. Déduisez le nom du phénomène responsable des deux possibilités en indiquant son effet sur la transmission de l’information génétique.

1. figure a : prophase I → formation des tétrades.

– figure b : anaphase I→ migration polaire des chromosomes sans clivage des centromères.

– figure c : anaphase II → migration polaire après clivage des centromères. 

– figure d : métaphase II →  plaque équatoriale constituée de n chromosomes  formés de deux chromatides.

– le phénomène étudié : la méiose.

2. schéma de la deuxième possibilité de l’anaphase I.  

-le phénomène responsable des deux possibilités : la ségrégation indépendante des allèles (brassage interchromosomique) qui aboutit à la diversification de l’information génétique des cellules filles (gamètes) issues de la méiose.

Fermer le menu